Sequence Meta Information:
Saccharibacteria (TM7) [G-1] bacterium HMT 488  [ UW ]
Info available in HOMD database:  
1Oral Taxon ID488
2HOMD Sequence IDSEQF2844
3HOMD Name (Genus, Species)Saccharibacteria (TM7) [G-1] bacterium HMT 488
4Genome Sequence Name
(Name associated with genomic sequence)
Candidate division TM7 single-cell isolate TM7-488
5Comments on Name
6Culture Collection Entry NumberNA
7Isolate OriginNA
8Sequencing StatusComplete
9NCBI Genome Project IDNA
10NCBI Taxonomy ID1895827
11Genomes Online Goldstamp IDNA
12GenBank Accession IDNA
13JCVI (TIGR) CMR IDNA
14Sequencing CenterNA
15Comments on GC Percentage
16ATCC Medium NumberNA
17Non-ATCC MediumNA
1816S rRNA Gene Sequence
>fig|6666666.232436.rna.10 Small Subunit Ribosomal RNA ssuRNA SSU rRNA 144773-146244
cctggacgcggggatttccgaagggaaatcagccgcatcatttccaaaggagtgagtgtc
tggggtgatttcaaactgatagtgcagaatgccggcgagcggcgaacggctgagtaacgc
gtaggaatttgccccaaagtgagggataactgcccgaaagggtagctaataccgcatatg
gtcttcggattaaaggatttatccgctttgggagaagcctgcgttggattaggttgttgg
tgaggtaatggctcaccaagccgacgatccatagctggtctgagaggatgatcagccaga
ctggaactgagacacggtccagactcctacgggaggcagcagtgaggaatcttccacaat
gggcgaaagcctgatggagcaacgccgcgtgaaggatgaaggccttcgggttgtaaactt
cttttatgagtgaagaatatgacggtaactcatgaataagcaccggctaactacgtgcca
gcagccgcggtcatacgtagggtgcaagcattatccggagtgactgggcgtaaagagttg
cgtaggcggtaagtcaagtgaatagtgaaacctggtggctcaaccatacagactattatt
caaactggcttactcgagaatggtagaggtaactggaatttcttgtgtaggagtgaaatc
cgtagatataagaaggaacaccaatggcgtaggcaggttactgggccatttctgacgcta
aggcacgaaagcgtggggagcgaaccggattagatacccgggtagtccacgccgtaaacg
atggatactagctgttggaggtatcgaccccttcagtagcgaagctaacgcgttaagtat
cccgcctgtggagtacggccgcaaggctaaaacataaaggaattgacggggacccgcaca
agcggtggattatgttctttaattcgatgataaccgaagaaccttaccagggcttgacat
ctagggaaggtctgcgaaagtagactgtgccttttggaaccctgtgacaggtgatgcatg
gccgtcgtcagctcgtgtcgtgagatgttaggttaagtccttcaacgagcgcaacccttg
caagtagttgtatttttctacttggactgccccggtaacggggaggaaggaggggatgat
gtcaggtcagtatttcccttacgtcctgggctagaaacgtaatacaatggctagtacaat
gcgcagcgaagccgcgaggtgaagcaaatcgcatcaaagctagtcccagttcggattgga
ggctgaaactcgcctccatgaagtcggaatcgctagtaatcgcaaatcagcaagttgcgg
tgaatacgttcccgggtcttgtacacaccgcccgtcaaaccatgaaagtgaccaacaccc
gaagtccgattcgtcggcctaaggtggggggcatgattggggttaagtcgtaacaaggta
tccgtaccggaaggtgcggatggattacctcc
19Comments for 16s rRNA Gene Sequence

Copyright 2007-2019 The Forsyth Institute