16S rRNA Refseq V15.21 Genomic RefSeq V9.12
Sequence Meta Information:
Aggregatibacter paraphrophilus W10433
Info available in HOMD database:  
1Oral Taxon ID720
2HOMD Sequence IDSEQF2660
3HOMD Name (Genus, Species)Aggregatibacter paraphrophilus
4Genome Sequence Name
(Name associated with genomic sequence)
Aggregatibacter paraphrophilus
5Comments on NameNA
6Culture Collection Entry NumberW10433
7Isolate OriginNA
8Sequencing StatusPending
9NCBI Genome Project IDNA
10NCBI Taxonomy IDNA
11Genomes Online Goldstamp IDNA
12GenBank Accession IDNA
13JCVI (TIGR) CMR IDNA
14Sequencing CenterBaylor College of Medicine
15Comments on GC PercentageNA
16ATCC Medium NumberNA
17Non-ATCC MediumNA
1816S rRNA Gene Sequence
 

>SEQF2660 Aggregatibacter paraphrophilus strain W10433, oral taxon 720, 16S ribosomal RNA gene, partial sequence

GAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCTTAACACATGCAAGTCGAACGGTAGCAGGTAAGT

ACTTGTACTTATGCTGACGAGTGGCGGACGGGTGAGTAATGCTTGGGGATCTGGCTTATGGAGGGGGATAACG

ACGGGAAACTGTCGCTAATACCGCGTAGAATCGAGAGATGAAAGTGTGGGACCTTCGGGCCACATGCCATAGG

ATGAACCCAAGTGGGATTAGGTAGTTGGTRGGGTAATGGCCTACCAAGCCGACGATCTCTAGCTGGTCTGAGA

GGATGACCAGCCACACCGGGACTGAGACACGGCCCGGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCGCA

ATGGGGGCAACCCTGACGCAGCCATGCCGCGTGAATGAAGAAGGCCTTCGGGTTGTAAAGTTCTTTCGGTGAC

GAGGAAGGTTGTTGTGTGAATAGCACAACAAATTGACGTTAATCACAGAAGAAGCACCGGCTAACTCCGTGCC

AGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGACTT

TTAAGTGAGGTGTGAAATCCCCGGGCTTAACCTGGGAATTGCATTTCAGACTGGGGGTCTAGAGTACTTTAGG

GAGGGGTAGAATTCCACGTGTAGCGGTGAAATGCGTAGAGATGTGGAGGAATACCGAAGGCGAAGGCAGCCCC

TTGGGAATGTACTGACGCTCATGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCT

GTAAACGCTGTCGATTTGGGGATTGGGCTTTGAGCTTGGTGCCCGTAGCTAACGTGATAAATCGACCGCCTGG

GGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAA

TTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATCCATGGRATCYTGTAGAGATAYGRGAGTGCCTTCG

GGAACCATGAGACAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAGTCCCGCAACGA

GCGCAACCCTTATCCTTTGTTGCCAGCGATTAGGTCGGGAACTCAAAGGAGACTGCCGGTGATAAACCGGAGG

AAGGTGGGGATGACGTCAAGTCATCATGGCCCTTACGAGTAGGGCTACACACGTGCTACAATGGCGTATACAG

AGGGCGACGAAGCCGCGAGGTGGAGTGAATCTCAGAAAGTACGTCTAAGTCCGGATTGGAGTCTGCAACTCGA

CTCCATGAAGTCGGAATCGCTAGTAATCGCGAATCAGAATGTCGCGGTGAATACGTTCCCGGGCCTTGTACAC

ACCGCCCGTCACACCATGGGAGTGGGTTGTACCAGAAGTAGATAGCTTAACCGCAAGGGGGGCGTTTACCACG

GTATGATTCATGACTGGGGTGAAGTCGTAACAAGGTAACCGTAGGGGAACCTGCGGTTGGATCACCTCCTTC

19Comments for 16s rRNA Gene SequenceNA
Copyright 2007-2020 The Forsyth Institute
Hosted on Amazon AWS EC2