16S rRNA Refseq V15.21 Genomic RefSeq V9.13
Sequence Meta Information:
Treponema denticola AL-2/F0461
Info available in HOMD database:  
1Oral Taxon ID584
2HOMD Sequence IDSEQF1873
3HOMD Name (Genus, Species)Treponema denticola
4Genome Sequence Name
(Name associated with genomic sequence)
Treponema denticola
5Comments on Name
6Culture Collection Entry NumberAL-2/F0461
7Isolate OriginNA
8Sequencing StatusHigh Coverage
9NCBI Genome Project ID64903
10NCBI Taxonomy ID999426
11Genomes Online Goldstamp IDGi07986
12GenBank Accession IDAGDQ00000000
13JCVI (TIGR) CMR IDNA
14Sequencing CenterThe Forsyth Institute - Broad Institute
15Comments on GC PercentageNA
16ATCC Medium NumberNA
17Non-ATCC MediumNA
1816S rRNA Gene Sequence

>SEQF 1873 Treponema denticola strain AL-2/F0461, OT 584,
16S ribosomal RNA gene, partial sequence
GAGTTTGATCCTGGCTCAGAACGAACGCTGGCGGCGCGTCTTAAGCATGC
AAGTCGAACGGTAAGGGAGAGCTTGCTCTCCCCTAGAGTGGCGGACTGGT
GAGTAACGCGTGGGTGACCTGCCCTGAAGATGGGGATAGCTAGTAGAAAT
ATTAGATAATACCGAATGTGCTCATTTACATAAAGGTAAATGAGGAAAGG
AGCTACGGCTCCGCTTCAGGATGGGCCCGCGTCCCATTAGCTAGTTGGTG
AGGTAAAGGCCCACCAAGGCAACGATGGGTATCCGGCCTGAGAGGGTGAA
CGGACACATTGGGACTGAGATACGGCCCAAACTCCTACGGGAGGCAGCAG
CTAAGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCGACGCCGTGTGA
ATGAAGAAGGCCGAAAGGTTGTAAAATTCTTTTGCAGATGAAGAATAAGA
AGAAGAGGGAATGCTTCTTTGATGACGGTAGTCATGCGAATAAGCCCCGG
CTAATTACGTGCCAGCAGCCGCGGTAACACGTAAGGGGCGAGCGTTGTTC
GGAATTATTGGGCGTAAAGGGTATGTAGGCGGTTAGGTAAGCCTGGTGTG
AAATCTACGAGCTCAACTCGTAAACTGCATTGGGTACTGCTTGACTTGAA
TCACGGAGGGGAAACCGGAATTCCAAGTGTAGGGGTGGAATCTGTAGATA
TTTGGAAGAACACCGGTGGCGAAGGCGGGTTTCTGGCCGATGATTGACGC
TGATATACGAAGGTGCGGGGAGCAAACAGGATTAGATACCCTGGTAGTCC
GCACAGTAAACGATGTACACTAGGTGTCGGGGCAAGAGCTTCGGTGCCGA
CGCAAACGCATTAAGTGTACCGCCTGGGAAGTATGCCCGCAAGGGTGAAA
CTCAAAGGAATTGACGGGGGCCCACACAAGCGGTGGAGCATGTGGTTTAA
TTCGATGATACGCGAGAAACCTTACCTGGGTTTGACATCAAGAGCAATGA
CATAGAGATATGGCAGCGTAGCAATACGGCTCTTGACAGGTGCTGCATGG
CTGTCGTCAGCTCGTGCCGTGAGGTGTTGGGTTAAGTCCCGCAACGAGCG
CAACCCCTACTGCCAGTTACTAACAGGTAAAGCTGAGGACTCTGGCGGAA
CTGCCGATGACAAATCGGAGGAAGGTGGGGATGACGTCAAGTCATCATGG
CCCTTACGTCCAGGGCTACACACGTGCTACAATGGTTGCTACAAATCGAA
GCGACACCGCGAGGTCAAGCAAAACGCAAAAAAGCAATCGTAGTCCGGAT
TGAAGTCTGAAACTCGACTTCATGAAGTTGGAATCGCTAGTAATCGCACA
TCAGCACGGTGCGGTGAATACGTTCCTGGGCCTTGTACACACCGCCCGTC
ACACCATCCGAGTCGAGGGTACCCGAAGTCGCTAGTCTAACCCGTAAGGG
AGGACGGTGCCGAAGGTACGTTTGGTAAGGAGGTGAAGTCGTAACAAGGT
A

19Comments for 16s rRNA Gene Sequence
Copyright 2007-2020 The Forsyth Institute
Hosted on Amazon AWS EC2
192.168.0.51