16S rRNA Refseq V15.21 Genomic RefSeq V9.13
Sequence Meta Information:
Treponema denticola ASLM/F0460
Info available in HOMD database:  
1Oral Taxon ID584
2HOMD Sequence IDSEQF1872
3HOMD Name (Genus, Species)Treponema denticola
4Genome Sequence Name
(Name associated with genomic sequence)
Treponema denticola
5Comments on Name
6Culture Collection Entry NumberASLM/F0460
7Isolate OriginNA
8Sequencing StatusHigh Coverage
9NCBI Genome Project ID64905
10NCBI Taxonomy ID999427
11Genomes Online Goldstamp IDGi07985
12GenBank Accession IDAGDR00000000
13JCVI (TIGR) CMR IDNA
14Sequencing CenterThe Forsyth Institute - Broad Institute
15Comments on GC PercentageNA
16ATCC Medium NumberNA
17Non-ATCC MediumNA
1816S rRNA Gene Sequence

>SEQF 1872 Treponema denticola strain ASLM/F0460, OT 584,
16S ribosomal RNA gene, partial sequence
GAGTTTGATCCTGGCTCAGAACGAACGCTGGCGGCGCGTCTTAAGCATGC
AAGTCGAACGGTAAGGGAGAGCTTGCTCTCCCCTAGAGTGGCGGACTGGT
GAGTAACGCGTGGGTGACCTGCCCTGAAGATGGGGATAGCTAGTAGAAAT
ATTAGATAATACCGAATGTGCTCATTTACATAAAGGTAAATGAGGAAAGG
AGCTACGGCTCCGCTTCAGGATGGGCCCGCGTCCCATTAGCTGGTTGGTG
AGGTAAAGGCCCACCAAGGCAACGATGGGTATCCGGCCTGAGAGGGTGAA
CGGACACATTGGGACTGAGATACGGCCCAAACTCCTACGGGAGGCAGCAG
CTAAGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCGACGCCGTGTGA
ATGAAGAAGGCCGAAAGGTTGTAAAATTCTTTTGCAGATGAAGAATAAGA
AGAAGAGGGAATGCTTCTTTGATGACGGTAGTCATGCGAATAAGCCCCGG
CTAATTACGTGCCAGCAGCCGCGGTAACACGTAAGGGGCGAGCGTTGTTC
GGAATTATTGGGCGTAAAGGGTATGTAGGCGGTTAGGTAAGCCTGGTGTG
AAATCTACGAGCTCAACTCGTAAACTGCATTGGGTACTGCTTGACTTGAA
TCACGGAGGGGAAACCGGAATTCCAAGTGTAGGGGTGGAATCTGTAGATA
TTTGGAAGAACACCGGTGGCGAAGGCGGGTTTCTGGCCGATGATTGACGC
TGATATACGAAGGTGCGGGGAGCAAACAGGATTAGATACCCTGGTAGTCC
GCACAGTAAACGATGTACACTAGGTGTCGGGGCAAGAGCTTCGGTGCCGA
CGCAAACGCATTAAGTGTACCGCCTGGGAAGTATGCCCGCAAGGGTGAAA
CTCAAAGGAATTGACGGGGGCCCACACAAGCGGTGGAGCATGTGGTTTAA
TTCGATGATACGCGAGAAACCTTACCTGGGTTTGACATCAAGAGCAATGA
CATAGAGATATGGCAGCGTAGCAATACGGCTCTTGACAGGTGCTGCATGG
CTGTCGTCAGCTCGTGCCGTGAGGTGTTGGGTTAAGTCCCGCAACGAGCG
CAACCCCTACTGCCAGTTACTAACAGGTAAAGCTGAGGACTCTGGCGGAA
CTGCCGATGACAAATCGGAGGAAGGTGGGGATGACGTCAAGTCATCATGG
CCCTTACGTCCAGGGCTACACACGTGCTACAATGGTTGCTACAAATCGAA
GCGACACCGCGAGGTCAAGCAAAACGCAAAAAAGCAATCGTAGTCCGGAT
TGAAGTCTGAAACTCGACTTCATGAAGTTGGAATCGCTAGTAATCGCACA
TCAGCACGGTGCGGTGAATACGTTCCTGGGCCTTGTACACACCGCCCGTC
ACACCATCCGAGTCGAGGGTACCCGAAGTCGCTAGTCTAACCCGTAAGGG
AGGACGGTGCCGAAGGTACGTTTGGTAAGGAGGGTGAAGTCGTAACAAGG
TA

19Comments for 16s rRNA Gene Sequence
Copyright 2007-2020 The Forsyth Institute
Hosted on Amazon AWS EC2
192.168.0.51