Sequence Meta Information:
Treponema denticola ATCC 35404
Info available in HOMD database:  
1Oral Taxon ID584
2HOMD Sequence IDSEQF1864
3HOMD Name (Genus, Species)Treponema denticola
4Genome Sequence Name
(Name associated with genomic sequence)
Treponema denticola
5Comments on Name
6Culture Collection Entry NumberATCC 35404
7Isolate OriginNA
8Sequencing StatusHigh Coverage
9NCBI Genome Project ID64911
10NCBI Taxonomy ID999430
11Genomes Online Goldstamp IDGi07977
12GenBank Accession IDAGDU00000000
13JCVI (TIGR) CMR IDNA
14Sequencing CenterThe Forsyth Institute - Broad Institute
15Comments on GC Percentage
16ATCC Medium NumberNA
17Non-ATCC MediumNA
1816S rRNA Gene Sequence

>SEQF 1864 Treponema denticola strain ATCC 35404, OT 584,
16S ribosomal RNA gene, partial sequence
GAGTTTGATCCTGGCTCAGAACGAACGCTGGCGGCGCGTCTTAAGCATGC
AAGTCGAACGGTAAGGGAGAGCTTGCTCTCCCCTAGAGTGGCGGACTGGT
GAGTAACGCGTGGGTGACCTGCCCTGAAGATGGGGATAGCTAGTAGAAAT
ATTAGATAATACCGAATGTGCTCATTTACATAAAGGTAAATGAGGAAAGG
AGCTACGGCTCCGCTTCAGGATGGGCCCGCGTCCCATTAGCTRGTTGGTG
AGGTAAAGGCCCACCAAGGCAACGATGGGTATCCGGCCTGAGAGGGTGAA
CGGACACATTGGGACTGAGATACGGCCCAAACTCCTACGGGAGGCAGCAG
CTAAGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCGACGCCGTGTGA
ATGAAGAAGGCCGAAAGGTTGTAAAATTCTTTTGCAGATGAAGAATAAGA
AGAAGAGGGAATGCTTCTTTGATGACGGTAGTCATGCGAATAAGCCCCGG
CTAATTACGTGCCAGCAGCCGCGGTAACACGTAAGGGGCGAGCGTTGTTC
GGAATTATTGGGCGTAAAGGGTATGTAGGCGGTTAGGTAAGCCTGGTGTG
AAATCTACGAGCTCAACTCGTAAACTGCATTGGGTACTGCTTGACTTGAA
TCACGGAGGGGAAACCGGAATTCCAAGTGTAGGGGTGGAATCTGTAGATA
TTTGGAAGAACACCGGTGGCGAAGGCGGGTTTCTGGCCGATGATTGACGC
TGATATACGAAGGTGCGGGGAGCAAACAGGATTAGATACCCTGGTAGTCC
GCACAGTAAACGATGTACACTAGGTGTCGGGGCAAGAGCTTCGGTGCCGA
CGCAAACGCATTAAGTGTACCGCCTGGGAAGTATGCCCGCAAGGGTGAAA
CTCAAAGGAATTGACGGGGGCCCACACAAGCGGTGGAGCATGTGGTTTAA
TTCGATGATACGCGAGAAACCTTACCTGGGTTTGACATCAAGAGCAATGA
CATAGAGATATGGCAGCGTAGCAATACGGCTCTTGACAGGTGCTGCATGG
CTGTCGTCAGCTCGTGCCGTGAGGTGTTGGGTTAAGTCCCGCAACGAGCG
CAACCCCTACTGCCAGTTACTAACAGGTAAAGCTGAGGACTCTGGCGGAA
CTGCCGATGACAAATCGGAGGAAGGTGGGGATGACGTCAAGTCATCATGG
CCCTTACGTCCAGGGCTACACACGTGCTACAATGGTTGCTACAAATCGAA
GCGACACCGCGAGGTCAAGCAAAACGCAAAAAAGCAATCGTAGTCCGGAT
TGAAGTCTGAAACTCGACTTCATGAAGTTGGAATCGCTAGTAATCGCACA
TCAGCACGGTGCGGTGAATACGTTCCTGGGCCTTGTACACACCGCCCGTC
ACACCATCCGAGTCGAGGGTACCCGAAGTCGCTAGTCTAACCCGTAAGGG
AGGACGGTGCCGAAGGTACGTTTGGTAAGGAGGGGGTAAAGTCGTAACAA
GGTA

19Comments for 16s rRNA Gene Sequence

Copyright 2007-2018 The Forsyth Institute